Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAAV-CreLite
(Plasmid #131785)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 131785 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV
  • Backbone manufacturer
    From William Lagor Lab
  • Backbone size w/o insert (bp) 3271
  • Total vector size (bp) 6862
  • Modifications to backbone
    Removed WPRE sequence and added a synthetic polyA sequence
  • Vector type
    Mammalian Expression, AAV, Cre/Lox, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PhyBCreC-P2A-PIF6CreN
  • Alt name
    CreALite
  • Species
    A. thaliana (mustard weed), Synthetic; Bacteriophage P1
  • Insert Size (bp)
    3591
  • GenBank ID
    816394 825382
  • Promoter CBh

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site MluI (not destroyed)
  • 5′ sequencing primer CBh_F: ttctgcttcactctccccatc
  • 3′ sequencing primer SynPA Rev: cacacaaaaaaccaacacacagatctaatg
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    This synthetic gene was originally designed and cloned by Shuo-Ting Yen and then the sequence was modified by William Lagor for cloning purpose. Finally, the insert was synthesized by GeneWiz. The final cloning step is done by Shuo-Ting Yen.
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CreLite was a gift from George Eisenhoffer (Addgene plasmid # 131785 ; http://n2t.net/addgene:131785 ; RRID:Addgene_131785)
  • For your References section:

    CreLite: An Optogenetically Controlled Cre/loxP System Using Red Light. Yen ST, Trimmer KA, Aboul N, Mullen RD, Culver JC, Dickinson ME, Behringer RR, Eisenhoffer GT. bioRxiv 10.1101/823971