Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pZmUBQ:LUC
(Plasmid #131860)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 131860 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pZmUBQ
  • Backbone size w/o insert (bp) 4344
  • Total vector size (bp) 5997
  • Vector type
    Plant Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    luciferase
  • Species
    firefly
  • Insert Size (bp)
    1653
  • Promoter ZmUBQ

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer TTAGCCCTGCCTTCATACGC
  • 3′ sequencing primer ACCGCGCGCGATAATTTATC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pZmUBQ:LUC was a gift from Paul Schulze-Lefert (Addgene plasmid # 131860 ; http://n2t.net/addgene:131860 ; RRID:Addgene_131860)
  • For your References section:

    A cell death assay in barley and wheat protoplasts for identification and validation of matching pathogen AVR effector and plant NLR immune receptors. Saur IML, Bauer S, Lu X, Schulze-Lefert P. Plant Methods. 2019 Oct 24;15:118. doi: 10.1186/s13007-019-0502-0. eCollection 2019. 10.1186/s13007-019-0502-0 PubMed 31666804