Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #132700)


Item Catalog # Description Quantity Price (USD)
Plasmid 132700 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    Low Copy


  • Gene/Insert name
    Maltose binding Protein
  • Species
    Escherichia coli
  • Promoter pBAD
  • Tags / Fusion Proteins
    • His (N terminal on backbone)
    • Avi (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BspQI (not destroyed)
  • 3′ cloning site BspQI (not destroyed)
  • 5′ sequencing primer ATGCCATAGCATTTTTATCC
  • 3′ sequencing primer GATTTAATCTGTATCAGG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBXNH3CA_MBP was a gift from Markus Seeger (Addgene plasmid # 132700 ; ; RRID:Addgene_132700)
  • For your References section:

    Generation of synthetic nanobodies against delicate proteins. Zimmermann I, Egloff P, Hutter CAJ, Kuhn BT, Brauer P, Newstead S, Dawson RJP, Geertsma ER, Seeger MA. Nat Protoc. 2020 Apr 8. pii: 10.1038/s41596-020-0304-x. doi: 10.1038/s41596-020-0304-x. 10.1038/s41596-020-0304-x PubMed 32269381