pUC-GFP-MCC
(Plasmid
#133307)
-
Purpose"Burdensome" GFP expressing plasmid carrying microcin-V bacteriocin for plasmid stabilisation
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 133307 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSF_UC_OXB20-daGFP
-
Backbone manufacturerOxford Genetics
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 9521
-
Modifications to backboneoriginal SC101 ori replaced with pUC ori
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemicrocin-V bacteriocin cassette
-
Alt namemccV
-
SpeciesE. coli
-
MutationN112D (please see depositors comments)
-
Entrez GenecvaC (a.k.a. CR540_RS26765, CR540_28145)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (unknown if destroyed)
- 3′ cloning site XbaI (unknown if destroyed)
- 5′ sequencing primer ACTGCTGATCGAGTGTAGCCA
- 3′ sequencing primer CTGTGAGCTGAAGGTACGCTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Original mccV cassette from:
Gilson, L., Mahanty, H.K. and Kolter, R., 1987. Four plasmid genes are required for colicin V synthesis, export, and immunity. Journal of bacteriology, 169(6), pp.2466-2470.
PMID: 3034857
Depositor confirms N112D mutation in the first insert does not affect function of the plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUC-GFP-MCC was a gift from Chris Barnes (Addgene plasmid # 133307 ; http://n2t.net/addgene:133307 ; RRID:Addgene_133307) -
For your References section:
Two New Plasmid Post-segregational Killing Mechanisms for the Implementation of Synthetic Gene Networks in Escherichia coli. Fedorec AJH, Ozdemir T, Doshi A, Ho YK, Rosa L, Rutter J, Velazquez O, Pinheiro VB, Danino T, Barnes CP. iScience. 2019 Apr 26;14:323-334. doi: 10.1016/j.isci.2019.03.019. Epub 2019 Mar 22. 10.1016/j.isci.2019.03.019 PubMed 30954530