Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is operating at a reduced capacity.

  • Pending order? We will email to confirm that your organization can accept shipments.
  • Conducting coronavirus or COVID-19 research? Email us at [email protected] with your order or deposit number so we can prioritize it.

Learn more about our current shipping status and COVID-19 resources.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pUC-GFP-MCC
(Plasmid #133307)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 133307 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSF_UC_OXB20-daGFP
  • Backbone manufacturer
    Oxford Genetics
  • Backbone size w/o insert (bp) 4700
  • Total vector size (bp) 9521
  • Modifications to backbone
    original SC101 ori replaced with pUC ori
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    microcin-V bacteriocin cassette
  • Alt name
    mccV
  • Species
    E. coli
  • Mutation
    N112D (please see depositors comments)
  • Entrez Gene
    cvaC (a.k.a. CR540_RS26765, CR540_28145)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (unknown if destroyed)
  • 3′ cloning site XbaI (unknown if destroyed)
  • 5′ sequencing primer ACTGCTGATCGAGTGTAGCCA
  • 3′ sequencing primer CTGTGAGCTGAAGGTACGCTG
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses

Depositor Comments

Original mccV cassette from:
Gilson, L., Mahanty, H.K. and Kolter, R., 1987. Four plasmid genes are required for colicin V synthesis, export, and immunity. Journal of bacteriology, 169(6), pp.2466-2470.
PMID: 3034857

Depositor confirms N112D mutation in the first insert does not affect function of the plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUC-GFP-MCC was a gift from Chris Barnes (Addgene plasmid # 133307 ; http://n2t.net/addgene:133307 ; RRID:Addgene_133307)
  • For your References section:

    Two New Plasmid Post-segregational Killing Mechanisms for the Implementation of Synthetic Gene Networks in Escherichia coli. Fedorec AJH, Ozdemir T, Doshi A, Ho YK, Rosa L, Rutter J, Velazquez O, Pinheiro VB, Danino T, Barnes CP. iScience. 2019 Apr 26;14:323-334. doi: 10.1016/j.isci.2019.03.019. Epub 2019 Mar 22. 10.1016/j.isci.2019.03.019 PubMed 30954530