Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMW#3
(Plasmid #13350)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 13350 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLacZi
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 9700
  • Vector type
    Yeast Expression
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DB3.1
  • Growth instructions
    DB3.1 (Invitrogen)
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LacZ reporter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer GTTCGGAGATTACCGAATCAA (1HIFW)
  • 3′ sequencing primer ATGCGCTCAGGTCAAATTCAGA (LacZ592RV)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note mutation R15H in ccdB was found during Addgene's quality control process. The plasmid should function as reported in the associated publication.

Please note that the ccdB cassette in the author's map (click on 'View map') is shown in the reverse orientation.

Y1H Destination vector that can be used in conventional Gateway LR cloning reactions. This vector contains a Gateway cassette with AttR4 and AttL1 recombination sites and a LacZ reporter gene. For more information and protocols, see Deplancke et al. 2004 Genome Res 14(10B):2093 and Deplancke et al. 2006 CSH Protocols.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMW#3 was a gift from Marian Walhout (Addgene plasmid # 13350 ; http://n2t.net/addgene:13350 ; RRID:Addgene_13350)
  • For your References section:

    A gene-centered C. elegans protein-DNA interaction network. Deplancke B, Mukhopadhyay A, Ao W, Elewa AM, Grove CA, Martinez NJ, Sequerra R, Doucette-Stamm L, Reece-Hoyes JS, Hope IA, Tissenbaum HA, Mango SE, Walhout AJ. Cell. 2006 Jun 16. 125(6):1193-205. 10.1016/j.cell.2006.04.038 PubMed 16777607