Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pJFRC-20XUAS-IVS-PhiC31
(Plasmid #133565)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 133565 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pJFRC7
  • Backbone manufacturer
    Janelia
  • Total vector size (bp) 9999
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PhiC31 Recombinase
  • Insert Size (bp)
    1842
  • Entrez Gene
    int (a.k.a. phiC31p51)
  • Promoter 20X UAS

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATCAGGTCCATGACGTTTCC
  • 3′ sequencing primer GGCGCCTAAGAAGAAGAGGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/788679v1 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJFRC-20XUAS-IVS-PhiC31 was a gift from Tom Clandinin (Addgene plasmid # 133565 ; http://n2t.net/addgene:133565 ; RRID:Addgene_133565)
  • For your References section:

    SPARC enables genetic manipulation of precise proportions of cells. Isaacman-Beck J, Paik KC, Wienecke CFR, Yang HH, Fisher YE, Wang IE, Ishida IG, Maimon G, Wilson RI, Clandinin TR. Nat Neurosci. 2020 Sep;23(9):1168-1175. doi: 10.1038/s41593-020-0668-9. Epub 2020 Jul 20. 10.1038/s41593-020-0668-9 PubMed 32690967