pZS160
(Plasmid
#134238)
-
PurposeLentiviral plasmid expressing sgRNA against HJURP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 134238 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLENTI-sgRNA
-
Backbone manufacturerEric Lander & David Sabatini (Addgene plasmid # 71409)
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHuman HJURP sgRNA
-
gRNA/shRNA sequenceGCCCTTCGAGGACACCCCGG
-
SpeciesH. sapiens (human)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pZS160 was a gift from Iain Cheeseman (Addgene plasmid # 134238 ; http://n2t.net/addgene:134238 ; RRID:Addgene_134238) -
For your References section:
Quiescent Cells Actively Replenish CENP-A Nucleosomes to Maintain Centromere Identity and Proliferative Potential. Swartz SZ, McKay LS, Su KC, Bury L, Padeganeh A, Maddox PS, Knouse KA, Cheeseman IM. Dev Cell. 2019 Oct 7;51(1):35-48.e7. doi: 10.1016/j.devcel.2019.07.016. Epub 2019 Aug 15. 10.1016/j.devcel.2019.07.016 PubMed 31422918