pcDNA3 PARL-FLAG-CT S65A+T69A+S70A
(Plasmid
#13616)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 13616 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3
- Backbone size w/o insert (bp) 5446
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePresenilin-associated rhomboid-like
-
Alt namePARL
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1164
-
Mutationchanged Ser 65, Thr 69 and Ser 70 to Alanine
-
GenBank IDAF197937
-
Entrez GenePARL (a.k.a. PRO2207, PSARL, PSARL1, PSENIP2, RHBDS1)
-
Entrez GenePARL (a.k.a. PARL)
-
Tag
/ Fusion Protein
- FLAG (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer GTACGGTGGGAGGTCTATAT (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3 PARL-FLAG-CT S65A+T69A+S70A was a gift from Luca Pellegrini (Addgene plasmid # 13616 ; http://n2t.net/addgene:13616 ; RRID:Addgene_13616) -
For your References section:
Phosphorylation and cleavage of presenilin-associated rhomboid-like protein (PARL) promotes changes in mitochondrial morphology. Jeyaraju DV, Xu L, Letellier MC, Bandaru S, Zunino R, Berg EA, McBride HM, Pellegrini L. Proc Natl Acad Sci U S A. 2006 Dec 5. 103(49):18562-7. 10.1073/pnas.0604983103 PubMed 17116872