pCAG-nirButterfly
(Plasmid
#136590)
-
PurposeExpression of a genetically-encoded voltage indicator nirButterfly
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 136590 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCAGGS
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namenirButterfly
-
SpeciesSynthetic
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer AGCCTCTGCTAACCATGTTC
- 3′ sequencing primer CCTTTATTAGCCAGAAGTCAGATG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/536359v1 for BioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-nirButterfly was a gift from Vladislav Verkhusha (Addgene plasmid # 136590 ; http://n2t.net/addgene:136590 ; RRID:Addgene_136590) -
For your References section:
Screening and Cellular Characterization of Genetically Encoded Voltage Indicators Based on Near-Infrared Fluorescent Proteins. Monakhov MV, Matlashov ME, Colavita M, Song C, Shcherbakova DM, Antic SD, Verkhusha VV, Knopfel T. ACS Chem Neurosci. 2020 Nov 4;11(21):3523-3531. doi: 10.1021/acschemneuro.0c00046. Epub 2020 Oct 16. 10.1021/acschemneuro.0c00046 PubMed 33063984