Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #136916)


Item Catalog # Description Quantity Price (USD)
Plasmid 136916 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 4843
  • Total vector size (bp) 6510
  • Vector type

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number


  • Gene/Insert name
  • Alt name
  • Species
  • Insert Size (bp)
  • Mutation
    H134R in ChR2
  • GenBank ID
  • Promoter Human Synapsin1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer accgccgcctcagcactgaa
  • 3′ sequencing primer agccatacgggaagcaatagca
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn-DFO-ChR2(H134R)-EYFP-WPRE was a gift from Ofer Yizhar (Addgene plasmid # 136916 ; ; RRID:Addgene_136916)
  • For your References section:

    Pathway-, layer- and cell-type-specific thalamic input to mouse barrel cortex. Sermet BS, Truschow P, Feyerabend M, Mayrhofer JM, Oram TB, Yizhar O, Staiger JF, Petersen CC. Elife. 2019 Dec 20;8. pii: 52665. doi: 10.7554/eLife.52665. 10.7554/eLife.52665 PubMed 31860443