pAAV-hSyn-DFO-ChR2(H134R)-EYFP-WPRE
(Plasmid
#136916)
-
PurposeExpresses ChR2(H134R)-EYFP in Cre-negative cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 136916 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 4843
- Total vector size (bp) 6510
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameChR2(H134R)-EYFP
-
Alt nameChR2
-
SpeciesSynthetic
-
Insert Size (bp)1667
-
MutationH134R in ChR2
-
GenBank IDAF461397.1
- Promoter Human Synapsin1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer accgccgcctcagcactgaa
- 3′ sequencing primer agccatacgggaagcaatagca (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
-
Article Citing this Plasmid
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-DFO-ChR2(H134R)-EYFP-WPRE was a gift from Ofer Yizhar (Addgene plasmid # 136916 ; http://n2t.net/addgene:136916 ; RRID:Addgene_136916) -
For your References section:
Pathway-, layer- and cell-type-specific thalamic input to mouse barrel cortex. Sermet BS, Truschow P, Feyerabend M, Mayrhofer JM, Oram TB, Yizhar O, Staiger JF, Petersen CC. Elife. 2019 Dec 20;8. pii: 52665. doi: 10.7554/eLife.52665. 10.7554/eLife.52665 PubMed 31860443