-
Purposeexpression of CD44 proteins in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 137812 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonemini pBR322
-
Backbone manufacturerlab Guenthert
- Backbone size w/o insert (bp) 4320
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418) ; GFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCD44s (fl)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1090
-
Mutationfull length, I186T and I253V on CD44
-
Entrez GeneCD44 (a.k.a. CDW44, CSPG8, ECM-III, ECMR-III, H-CAM, HCELL, HUTCH-1, HUTCH-I, Hermes-1, IN, LHR, MC56, MDU2, MDU3, MIC4, Pgp1)
- Promoter PGK
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoR1 (unknown if destroyed)
- 3′ cloning site BamH1 (unknown if destroyed)
- 5′ sequencing primer GTAATACGACTCACTATAGG
- 3′ sequencing primer GCTCACCATGGTGGCGACCG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene NGS result found mutations I186T and I253V when compared to CD44 [XP_016874074.1]. Depositor confirmed that this does not affect the function of the plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPGK-T7/2-CD44s (fl) was a gift from Ursula Gunthert (Addgene plasmid # 137812 ; http://n2t.net/addgene:137812 ; RRID:Addgene_137812) -
For your References section:
A novel antiapoptotic mechanism based on interference of Fas signaling by CD44 variant isoforms. Mielgo A, van Driel M, Bloem A, Landmann L, Gunthert U. Cell Death Differ. 2006 Mar;13(3):465-77. doi: 10.1038/sj.cdd.4401763. 10.1038/sj.cdd.4401763 PubMed 16167069