pET30b_T7Sav
(Plasmid #138588)

• Purpose: T7-tagged streptavidin with native C-terminus controlled by PT7 promoter; KanR, pBR322 ori
• Depositing Lab: Markus Jeschek
• Publication: Jeschek et al Metab Eng. 2017 Mar;40:33-40. doi: 10.1016/j.ymben.2016.12.013. Epub 2017 Jan 3.

Backbone

• Vector backbone: pET30b
• Backbone manufacturer: Novagen
• Total vector size (bp): 5761
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Glucose can be added to growth medium to reduce leaky expression
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: T7-tagged streptavidin variant with native C-terminus
• Alt name: T7SAV
• Species: Synthetic
• Insert Size (bp): 483
• Promoter: PT7
• Tag / Fusion Protein:
  • T7-tag (N terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: ATGCGTCCGGCGTAGA
• 3′ sequencing primer: TGCTAGTTATTGCTCAGCGG

Resource Information

• Supplemental Documents:
  • pET30bT7Sav.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry