pGL3-KRAS
(Plasmid #13919)

• Depositing Lab: Frank Slack
• Publication: Johnson et al Cell. 2005 Mar 11. 120(5):635-47.

Ordering

Item	Catalog #	Description	Quantity	Price (USD)
Plasmid	13919	Standard format: Plasmid sent in bacteria as agar stab	1	$65	Add to Cart

This material is available to academics and nonprofits only.

Backbone

• Vector backbone: pGL3 promoter
  (Search Vector Database)
• Backbone manufacturer: promega
• Vector type: Mammalian Expression, Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: KRAS 3'UTR
• Species: H. sapiens (human)
• Entrez Gene: KRAS (a.k.a. 'C-K-RAS, C-K-RAS, CFC2, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B, K-Ras, K-Ras 2, KI-RAS, KRAS1, KRAS2, NS, NS3, OES, RALD, RASK2, c-Ki-ras, c-Ki-ras2)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Xba1 (unknown if destroyed)
• 3′ cloning site: Xba1 (unknown if destroyed)
• 5′ sequencing primer: AAGGGCGGAAAGATCGCCGTG
• 3′ sequencing primer: AATGTATCTTATCATGTCTGCTCG

Resource Information

• Terms and Licenses:
  • UBMTA
  • Luciferase Limited Use Label License