Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pGL3-NRASshort
(Plasmid #13799)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 13799 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGL3 promoter
  • Backbone manufacturer
    promega
  • Backbone size w/o insert (bp) 5010
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NRAS
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1140
  • GenBank ID
    NM_002524
  • Entrez Gene
    NRAS (a.k.a. ALPS4, CMNS, N-ras, NCMS, NRAS1, NS6)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xba1 (destroyed during cloning)
  • 3′ cloning site Xba1 (destroyed during cloning)
  • 5′ sequencing primer AAGGGCGGAAAGATCGCCGTG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL3-NRASshort was a gift from Frank Slack (Addgene plasmid # 13799 ; http://n2t.net/addgene:13799 ; RRID:Addgene_13799)
  • For your References section:

    RAS is regulated by the let-7 microRNA family. Johnson SM, Grosshans H, Shingara J, Byrom M, Jarvis R, Cheng A, Labourier E, Reinert KL, Brown D, Slack FJ. Cell. 2005 Mar 11. 120(5):635-47. 10.1016/j.cell.2005.01.014 PubMed 15766527