pBMN-AS-HNF4α
(Plasmid #139305)

• Purpose: Knocking down of human HNF4α through shRNA and amiRNA targeting HNF4α
• Depositing Lab: Claes Wadelius
• Publication: Pan et al iScience. 2020 Jan 9:100808. doi: 10.1016/j.isci.2019.100808.

Backbone

• Vector backbone: pBMN(CMV-copGFP-Puro)
• Backbone manufacturer: Constructed from pGreenPuro (SBI) by Magnus Essand Lab
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: shRNA and amiRNA against HNF4α
• gRNA/shRNA sequence: shRNA targeting "GAACCACATGTACTCCTGCAGATT" and amiRNA targeting "TCAGCACTCGAAGGTCAAGCTAT" of human HNF4α mRNA
• Species: Synthetic
• Promoter: CMV

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: unknown

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry