pTFUbiCre
(Plasmid
#139670)
-
PurposeExpression cassette for Cre recombinase in T-DNA vector
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 139670 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepTF101
- Backbone size w/o insert (bp) 9189
- Total vector size (bp) 12635
-
Vector typePlant Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCre recombinase
-
Speciesbacteriophage p1
-
Insert Size (bp)1032
- Promoter Maize Ubiquitin
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GATGCTCACCCTGTTGTTTGGTGT
- 3′ sequencing primer AACGTGGGTAGCACCAAAAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Mutation A207T in Cre
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTFUbiCre was a gift from James Birchler (Addgene plasmid # 139670 ; http://n2t.net/addgene:139670 ; RRID:Addgene_139670) -
For your References section:
In vivo modification of a maize engineered minichromosome. Gaeta RT, Masonbrink RE, Zhao C, Sanyal A, Krishnaswamy L, Birchler JA. Chromosoma. 2013 Jun;122(3):221-32. doi: 10.1007/s00412-013-0403-3. Epub 2013 Mar 22. 10.1007/s00412-013-0403-3 PubMed 23519820
Map uploaded by the depositor.
