pLARRY-EGFP
(Plasmid #140025)

• Purpose: Lentiviral backbone for cloning expressed barcodes in the 3'UTR of the EGFP mRNA
• Depositing Lab: Fernando Camargo
• Publication: Weinreb et al Science. 2020 Jan 23. pii: science.aaw3381. doi: 10.1126/science.aaw3381.

Backbone

• Vector backbone: pLV
• Backbone size w/o insert (bp): 7712
• Total vector size (bp): 8432
• Modifications to backbone: Inverted cassette (EF1a promoter - unidirectional polyA)
• Vector type: Lentiviral
• Selectable markers: EGFP

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: EGFP
• Alt name: enhanced green fluorescent protein
• Species: Aequorea victoria
• GenBank ID: U55762.1
• Promoter: EF1alpha

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: cattctcaagcctcagacagtggtt
• 3′ sequencing primer: gaaggcacaggtcgacaccagt

Resource Information

• Supplemental Documents:
  • plarry_ef1a-egfp-no-barcode.gb
  • Barcoded plasmid preparation
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry