Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSLQ8636 PB-PGK-RR12EE345L-C term (406) dLbCpf1-N intein-pA
(Plasmid #140223)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 140223 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    PB
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    zipper with dLbCpf1 (Cas12a) C terminal half (406) fused to N-intein
  • Species
    Synthetic
  • Mutation
    D832A
  • Promoter PGK

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGCATTCTGCACGCTTCAAAAGC
  • 3′ sequencing primer tagaaggcacagtcgagg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLQ8636 PB-PGK-RR12EE345L-C term (406) dLbCpf1-N intein-pA was a gift from Stanley Qi (Addgene plasmid # 140223 ; http://n2t.net/addgene:140223 ; RRID:Addgene_140223)
  • For your References section:

    Multiple Input Sensing and Signal Integration Using a Split Cas12a System. Kempton HR, Goudy LE, Love KS, Qi LS. Mol Cell. 2020 Jan 30. pii: S1097-2765(20)30037-X. doi: 10.1016/j.molcel.2020.01.016. 10.1016/j.molcel.2020.01.016 PubMed 32027839