pGb_PMLlxP_EGFP
(Plasmid
#140283)
-
Purposea targeting plasmid for EGFP-PML
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 140283 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGbait
-
Vector typeMouse Targeting
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEGFP
- Promoter endogenous
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCTCTCCTCGGGCAATCTCT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGb_PMLlxP_EGFP was a gift from Yusuke Miyanari (Addgene plasmid # 140283 ; http://n2t.net/addgene:140283 ; RRID:Addgene_140283) -
For your References section:
Genomic Profiling by ALaP-Seq Reveals Transcriptional Regulation by PML Bodies through DNMT3A Exclusion. Kurihara M, Kato K, Sanbo C, Shigenobu S, Ohkawa Y, Fuchigami T, Miyanari Y. Mol Cell. 2020 May 7;78(3):493-505.e8. doi: 10.1016/j.molcel.2020.04.004. Epub 2020 Apr 29. 10.1016/j.molcel.2020.04.004 PubMed 32353257