1
Plasmid 14788: Hmga2 3'UTR m7 luciferase (Luc-m7)
  • Luc-m7

  • HMGA2

  • 3000

  • M. musculus (mouse)

  • BC052158

  • Hmga2 (9430083A20Rik, HMGI-C, Hmgic, pg, pygmy)

  • luciferase

  • N terminal on backbone

  • m7 mutant (see article and author's map for details)

  • pIS1
    (Search Vector Database)

  • Available from Addgene (#12179)

  • Mammalian Expression, Luciferase

  • 4000

  • XbaI

  • No

  • NotI

  • No

  • N/A List of Sequencing Primers

  • EBV rev primer

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (1)
  • View map

  • David Bartel

  • MTA
    Luciferase Limited Use Label License

Comments: 

The 3' UTR of the mouse Hmga2 cDNA (BC052158) was subcloned into pCR2.1-TOPO (Invitrogen) for site-directed mutagenesis. To disrupt each let-7 complementary site, the nucleotides that paired to nucleotides 3 and 5 of the miRNA were substituted (see Author's map), using the Quikchange site-directed mutagenesis kit (Stratagene). To construct the Renilla luciferase reporters, wild-type and mutant Hmga2 3' UTRs were amplified (PCR primers, 5'-GCGTCTCGAGGGGCGCCGACATTC and 5'GGCGCGGCCGCAGTCAGAGGGCACAC) and cloned into the XbaI and NotI sites of pIS1.

Full sequence of wild-type plasmid available at Addgene plasmid #14785.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Disrupting the pairing between let-7 and Hmga2 enhances oncogenic transformation. Mayr et al (Science. 2007 Mar 16. 315(5818):1576-9. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 14788" in your Materials and Methods section.