Hmga2 3'UTR m7 luciferase (Luc-m7)
(Plasmid #14788)

Available to Academic and Nonprofits Only

Backbone

  • Vector backbone
    pIS1
  • Backbone manufacturer
    Available from Addgene (#12179)
  • Backbone size w/o insert (bp) 4000
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Sequence Information

Full plasmid sequence is available only if provided by the depositing laboratory.

Gene/Insert

  • Gene/Insert name
    Luc-m7
  • Alt name
    HMGA2
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    3000
  • Mutation
    m7 mutant (see article and author's map for details)
  • GenBank ID
    BC052158
  • Entrez Gene
    Hmga2 (a.k.a. 9430083A20Rik, HMGI-C, Hmgic, pg, pygmy)
  • Tag / Fusion Protein
    • luciferase (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer N/A
  • 3′ sequencing primer EBV rev primer
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

The 3' UTR of the mouse Hmga2 cDNA (BC052158) was subcloned into pCR2.1-TOPO (Invitrogen) for site-directed mutagenesis. To disrupt each let-7 complementary site, the nucleotides that paired to nucleotides 3 and 5 of the miRNA were substituted (see Author's map), using the Quikchange site-directed mutagenesis kit (Stratagene). To construct the Renilla luciferase reporters, wild-type and mutant Hmga2 3' UTRs were amplified (PCR primers, 5'-GCGTCTCGAGGGGCGCCGACATTC and 5'GGCGCGGCCGCAGTCAGAGGGCACAC) and cloned into the XbaI and NotI sites of pIS1.

Full sequence of wild-type plasmid available at Addgene plasmid #14785.

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Hmga2 3'UTR m7 luciferase (Luc-m7) was a gift from David Bartel (Addgene plasmid # 14788)
  • For your References section:

    Disrupting the pairing between let-7 and Hmga2 enhances oncogenic transformation. Mayr C, Hemann MT, Bartel DP. Science. 2007 Mar 16. 315(5818):1576-9. 10.1126/science.1137999 PubMed 17322030