Modified Shipping Schedule: Addgene will be closed November 26th & 27th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of Nov 23 - 27. If you have any questions, please contact us at

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at Learn more

Hmga2 3'UTR m7 luciferase (Luc-m7)
(Plasmid #14788)

Add to Cart
Available to Academic and Nonprofits Only


  • Vector backbone
  • Backbone manufacturer
    Available from Addgene (#12179)
  • Backbone size w/o insert (bp) 4000
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

Sequence Information

Full plasmid sequence is available only if provided by the depositing laboratory.


  • Gene/Insert name
  • Alt name
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
  • Mutation
    m7 mutant (see article and author's map for details)
  • GenBank ID
  • Entrez Gene
    Hmga2 (a.k.a. 9430083A20Rik, HMGI-C, Hmgic, pg, pygmy)
  • Tag / Fusion Protein
    • luciferase (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer N/A
  • 3′ sequencing primer EBV rev primer
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

The 3' UTR of the mouse Hmga2 cDNA (BC052158) was subcloned into pCR2.1-TOPO (Invitrogen) for site-directed mutagenesis. To disrupt each let-7 complementary site, the nucleotides that paired to nucleotides 3 and 5 of the miRNA were substituted (see Author's map), using the Quikchange site-directed mutagenesis kit (Stratagene). To construct the Renilla luciferase reporters, wild-type and mutant Hmga2 3' UTRs were amplified (PCR primers, 5'-GCGTCTCGAGGGGCGCCGACATTC and 5'GGCGCGGCCGCAGTCAGAGGGCACAC) and cloned into the XbaI and NotI sites of pIS1.

Full sequence of wild-type plasmid available at Addgene plasmid #14785.

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Hmga2 3'UTR m7 luciferase (Luc-m7) was a gift from David Bartel (Addgene plasmid # 14788)
  • For your References section:

    Disrupting the pairing between let-7 and Hmga2 enhances oncogenic transformation. Mayr C, Hemann MT, Bartel DP. Science. 2007 Mar 16. 315(5818):1576-9. 10.1126/science.1137999 PubMed 17322030