-
PurposeBacterial expression of mKalama1 blue fluorescent protein
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 14892 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBad/His B
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 4100
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namemKalama1
-
Alt namemKalama1 blue fluorescent protein
-
Speciesevolved fluorescent protein
-
Insert Size (bp)720
-
MutationThe fluorescent protein was inserted between XhoI and EcoR1 of pBad/His B. There is an extra 'C' after XhoI to avoid the frameshift.
-
GenBank IDEF517317
-
Tag
/ Fusion Protein
- His (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer ATGCCATAGCATTTTTATCC
- 3′ sequencing primer GATTTAATCTGTATCAGG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBad-mKalama1 was a gift from Robert Campbell (Addgene plasmid # 14892 ; http://n2t.net/addgene:14892 ; RRID:Addgene_14892) -
For your References section:
Exploration of New Chromophore Structures Leads to the Identification of Improved Blue Fluorescent Proteins. Ai HW, Shaner NC, Cheng Z, Tsien RY, Campbell RE. Biochemistry. 2007 May 22;46(20):5904-10. doi: 10.1021/bi700199g 10.1021/bi700199g PubMed 17444659