Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is operating at a reduced capacity.

  • Pending order? We will email to confirm that your organization can accept shipments.
  • Conducting coronavirus or COVID-19 research? Email us at [email protected] with your order or deposit number so we can prioritize it.

Learn more about our current shipping status and COVID-19 resources.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pLDLR-Luc mutSRE
(Plasmid #14945)


Item Catalog # Description Quantity Price (USD)
Plasmid 14945 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
    pGL2 basic
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 5597
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    LDLR promoter mut SRE
  • Alt name
    LDL receptor promoter
  • Alt name
    LDL receptor
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Mutation
    Point mutation in the SRE-1 sequence of the LDL receptor promoter (ATCACCCCAC changed to ATAACCCCAC)
  • GenBank ID
  • Entrez Gene
    LDLR (a.k.a. FH, FHC, FHCL1, LDLCQ2)
  • Tag / Fusion Protein
    • luciferase (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer n/a
  • 3′ sequencing primer LucNrev
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Primers used for site-directed mutagenesis: 5'- ggtgaagacatttgaaaataaccccactgcaaactcc -3' and 5'-GGAGTTTGCAGTGGGGTTATTTTCAAATGTCTTCACC -3'

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLDLR-Luc mutSRE was a gift from Axel Nohturfft (Addgene plasmid # 14945 ; ; RRID:Addgene_14945)
  • For your References section:

    Transcriptional regulation of phagocytosis-induced membrane biogenesis by sterol regulatory element binding proteins. Castoreno AB, Wang Y, Stockinger W, Jarzylo LA, Du H, Pagnon JC, Shieh EC, Nohturfft A. Proc Natl Acad Sci U S A. 2005 Sep 13. 102(37):13129-34. 10.1073/pnas.0506716102 PubMed 16141315