Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

TMPRSS2 g4 + Cas9
(Plasmid #153018)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 153018 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Lenti-Cas9-gRNA-TagBFP2 (Addgene #124774)
  • Vector type
    Lentiviral, CRISPR
  • Selectable markers
    TagBFP2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cas9 + TMPRSS2 gRNA
  • gRNA/shRNA sequence
    CAATGCCATGGATTGTTAAG
  • Species
    H. sapiens (human)
  • Tag / Fusion Protein
    • TagBFP2

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TMPRSS2 g4 + Cas9 was a gift from Jason Sheltzer (Addgene plasmid # 153018 ; http://n2t.net/addgene:153018 ; RRID:Addgene_153018)