pQsupR-Mi2b
(Plasmid
#15379)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 15379 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepQsupR
-
Backbone manufacturerSmale Lab
- Backbone size w/o insert (bp) 8290
-
Vector typeRetroviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameshort hairpin RNA against mouse Mi-2 beta
-
Alt nameMi-2 beta
-
Alt nameMi-2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)66
-
Entrez GeneChd4 (a.k.a. 9530019N15Rik, D6Ertd380e, Mi-2beta, mKIAA4075)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BgIII (destroyed during cloning)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer ccatggaattcgaacgctgacgtc (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Target sequence: GACTACGACCTGTTCAAGCAG
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQsupR-Mi2b was a gift from Stephen Smale (Addgene plasmid # 15379 ; http://n2t.net/addgene:15379 ; RRID:Addgene_15379) -
For your References section:
Selective and antagonistic functions of SWI/SNF and Mi-2beta nucleosome remodeling complexes during an inflammatory response. Ramirez-Carrozzi VR, Nazarian AA, Li CC, Gore SL, Sridharan R, Imbalzano AN, Smale ST. Genes Dev. 2006 Feb 1. 20(3):282-96. 10.1101/gad.1383206 PubMed 16452502