pLOXp-GUS
(Plasmid #154059)

• Purpose: Level 0.5 Golden Gate vector, loxP-GUS-nosT-loxP
• Depositing Lab: Cristobal Uauy
• Publication: Harrington et al Plant Methods. 2020 Oct 14;16:137. doi: 10.1186/s13007-020-00677-3. eCollection 2020.

Backbone

• Vector backbone: EC10161
• Backbone manufacturer: Engineering Nitrogen Symbiosis for Africa (ENSA)
• Backbone size w/o insert (bp): 2503
• Total vector size (bp): 4791
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: beta-glucoronidase (E. coli)
• Alt name: GUS
• Species: E. coli
• Insert Size (bp): 2283
• Promoter: N/A

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsmBI (destroyed during cloning)
• 3′ cloning site: BsmBI (destroyed during cloning)
• 5′ sequencing primer: tgcacgtctcatactgacct
• 3′ sequencing primer: gcgtctcacattcaaccctt

Resource Information

• Supplemental Documents:
  • ploxp-gus.gb
• A portion of this plasmid was derived from a plasmid made by: pICH7511

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry