EC71171
(Plasmid #154069)

• Purpose: Level 0 Golden Gate vector, CRE with U5 intron at 254bp, in pICH41308 backbone
• Depositing Lab: Cristobal Uauy
• Publication: Harrington et al Plant Methods. 2020 Oct 14;16:137. doi: 10.1186/s13007-020-00677-3. eCollection 2020.

Backbone

• Vector backbone: pICH41308
• Backbone manufacturer: Sylvestre Marillonnet/ TSL SynBio
• Backbone size w/o insert (bp): 2221
• Total vector size (bp): 3477
• Vector type: Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CRE_U5intron
• Alt name: Cre Recombinase with the U5 intron
• Species: Synthetic
• Insert Size (bp): 1256
• Mutation: All BsaI, Esp3I and BPiI restriction sites were removed using synonymous changes. Cre Recombinase was modified by the inclusion of the Arabidopsis thaliana ribonucleoprotein U5 intron at 254bp.

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BpiI (destroyed during cloning)
• 3′ cloning site: BpiI (destroyed during cloning)
• 5′ sequencing primer: GCCAGCAACGCGGCCTTTTTAC
• 3′ sequencing primer: CCACTTCGTGGTCTCAAAGC

Resource Information

• Supplemental Documents:
  • ec71171_ec71102-pl0m-sc-cre_with_u5_intron_design.gb
  • ec71171_cre_u5_pich41308.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry