Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

XLone-BSD SARS-CoV2 N P2A mCherry
(Plasmid #154398)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 154398 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    XLone-GFP Addgene #96930
  • Backbone manufacturer
    Xiaojun Lian Lab
  • Backbone size w/o insert (bp) 5599
  • Total vector size (bp) 7714
  • Vector type
    Mammalian Expression ; Piggybac
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SARS-CoV2 N Protein
  • Alt name
    Nucleocapsid
  • Species
    SARS-CoV2
  • Insert Size (bp)
    1275
  • Entrez Gene
    N (a.k.a. GU280_gp10)
  • Promoter TRE3G
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site NheI or SpeI (not destroyed)
  • 5′ sequencing primer gcgcctataaaagagtgctga
  • 3′ sequencing primer M13 FWD
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    SARS-CoV-2-N was PCR amplified from Addgene plasmid #141391, gift from Dr. Nevan Krogan lab.

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    XLone-BSD SARS-CoV2 N P2A mCherry was a gift from Xiaoping Bao (Addgene plasmid # 154398 ; http://n2t.net/addgene:154398 ; RRID:Addgene_154398)