Holiday Schedule: Addgene will be closed December 23rd & 26th and December 30th & January 2nd. For details, see our holiday shipping schedule. If you have any questions, please contact us at

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at Learn more

(Plasmid #15474)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 15474 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    Partitioning-defective protein 6C
  • Alt name
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • GenBank ID
  • Entrez Gene
    PARD6A (a.k.a. PAR-6A, PAR6, PAR6C, PAR6alpha, TAX40, TIP-40)
  • Tag / Fusion Protein
    • Myc (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamH1 (not destroyed)
  • 3′ cloning site EcoR1 (not destroyed)
  • 5′ sequencing primer CAGGTCCAACTGCACCTCGGTTC
  • 3′ sequencing primer TTTGTGATGCTATTGCTTTATTTG TA
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pK-myc-Par6C was a gift from Ian Macara (Addgene plasmid # 15474)
  • For your References section:

    The cell-polarity protein Par6 links Par3 and atypical protein kinase C to Cdc42. Joberty G, Petersen C, Gao L, Macara IG. Nat Cell Biol 2000 Aug;2(8):531-9. 10.1038/35019573 PubMed 10934474