1
Plasmid 15474: pK-myc-Par6C
  • Partitioning-defective protein 6C

  • Par6C

  • PAR-6C

  • 1037

  • H. sapiens (human)

  • AF252292

  • PARD6A (PAR-6A, PAR6, PAR6C, PAR6alpha, TAX40, TIP-40)

  • Myc

  • N terminal on backbone

  • pKmyc
    (Search Vector Database)

  • Mammalian Expression

  • 4700

  • BamH1

  • No

  • EcoR1

  • No

  • CAGGTCCAACTGCACCTCGGTTC List of Sequencing Primers

  • TTTGTGATGCTATTGCTTTATTTG TA

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (1)
  • Ian Macara

  • UBMTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: The cell-polarity protein Par6 links Par3 and atypical protein kinase C to Cdc42. Joberty et al (Nat Cell Biol 2000 Aug;2(8):531-9. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 15474" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only