(Plasmid #15474)

Available to Academic and Nonprofits Only


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

Sequence Information

Full plasmid sequence is available only if provided by the depositing laboratory.


  • Gene/Insert name
    Partitioning-defective protein 6C
  • Alt name
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • GenBank ID
  • Entrez Gene
    PARD6A (a.k.a. PAR-6A, PAR6, PAR6C, PAR6alpha, TAX40, TIP-40)
  • Tag / Fusion Protein
    • Myc (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamH1 (not destroyed)
  • 3′ cloning site EcoR1 (not destroyed)
  • 5′ sequencing primer CAGGTCCAACTGCACCTCGGTTC
  • 3′ sequencing primer TTTGTGATGCTATTGCTTTATTTG TA
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pK-myc-Par6C was a gift from Ian Macara (Addgene plasmid # 15474)
  • For your References section:

    The cell-polarity protein Par6 links Par3 and atypical protein kinase C to Cdc42. Joberty G, Petersen C, Gao L, Macara IG. Nat Cell Biol 2000 Aug;2(8):531-9. 10.1038/35019573 PubMed 10934474