Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBMN-AS-YY1
(Plasmid #154943)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 154943 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBMN(CMV-copGFP-Puro)
  • Backbone manufacturer
    Constructed from pGreenPuro (SBI) by Magnus Essand Lab
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    shRNA and amiRNA against YY1
  • gRNA/shRNA sequence
    shRNA targeting "GCCTCTCCTTTGTATATTATT " and amiRNA targeting "GGGAGCAGAAGCAGGTGCAGAT" of human YY1 mRNA
  • Species
    H. sapiens (human), Synthetic
  • Entrez Gene
    YY1 (a.k.a. DELTA, GADEVS, INO80S, NF-E1, UCRBP, YIN-YANG-1)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBMN-AS-YY1 was a gift from Claes Wadelius (Addgene plasmid # 154943 ; http://n2t.net/addgene:154943 ; RRID:Addgene_154943)
  • For your References section:

    Multifaceted regulation of hepatic lipid metabolism by YY1. Pan G, Diamanti K, Cavalli M, Lara Gutierrez A, Komorowski J, Wadelius C. Life Sci Alliance. 2021 Jun 7;4(7). pii: 4/7/e202000928. doi: 10.26508/lsa.202000928. Print 2021 Jul. 10.26508/lsa.202000928 PubMed 34099540