XLone-Puro Cas13d-eGFP U6 BbsI
(Plasmid #155184)

• Purpose: (Empty Backbone) PiggybacTransposon-based tunable and temporal expression control of Cas13d- eGFP and U6 gRNA backbone
• Depositing Lab: Xiaoping Bao
• Publication: Chang et al Biomaterials. 2022 May 6;285:121569. doi: 10.1016/j.biomaterials.2022.121569.

Backbone

• Vector backbone: Addgene #155182
• Backbone size (bp): 9512
• Vector type: Mammalian Expression, Unspecified ; Piggybac transposon
• Promoter: U6
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: TTTCTTGGGTAGTTTGCAGTTTT
• 3′ sequencing primer: M13 RVS

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The T2A-Puro sequence was re-amplified and cloned into the backbone to remove BbsI restriction site in the T2A sequence. To clone Cas13d gRNA for gene knockdown, digest the plasmid with BbsI and then ligate annealed oligo into the backbone. gRNA could be designed using https://cas13design.nygenome.org/ and annealing oligoes should have the following format, where Ns and Ms are the gRNA sequence and its reverse-complement counterpart:
FWD:5'- AAACNNNNNNNNNNNNN
RVS: 5'-AAAAMMMMMMMMMMM