Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #155364)


Item Catalog # Description Quantity Price (USD)
Plasmid 155364 Standard format: Plasmid sent in bacteria as agar stab 1 $75 *

* Login to view industry pricing.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    Please use WK6 bacterial strain for expression: 37 C, with induction of protein expression by 1mM IPTG at OD ~ 1.2, and then grown overnight at 20 C
  • Copy number


  • Gene/Insert name
  • Species
  • Promoter T7
  • Tag / Fusion Protein
    • His6 (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GTGGGTATTTGTGAGCCAG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOPINO_NbH11-H4 was a gift from Ray Owens (Addgene plasmid # 155364 ; ; RRID:Addgene_155364)
  • For your References section:

    Neutralizing nanobodies bind SARS-CoV-2 spike RBD and block interaction with ACE2. Huo J, Le Bas A, Ruza RR, Duyvesteyn HME, Mikolajek H, Malinauskas T, Tan TK, Rijal P, Dumoux M, Ward PN, Ren J, Zhou D, Harrison PJ, Weckener M, Clare DK, Vogirala VK, Radecke J, Moynie L, Zhao Y, Gilbert-Jaramillo J, Knight ML, Tree JA, Buttigieg KR, Coombes N, Elmore MJ, Carroll MW, Carrique L, Shah PNM, James W, Townsend AR, Stuart DI, Owens RJ, Naismith JH. Nat Struct Mol Biol. 2020 Jul 13. pii: 10.1038/s41594-020-0469-6. doi: 10.1038/s41594-020-0469-6. 10.1038/s41594-020-0469-6 PubMed 32661423