Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed November 28th & 29th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of November 25th - 29th. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pRetrosuper USP28 shRNA-3
(Plasmid #15664)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 15664 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 6400
  • Vector type
    Mammalian Expression, Retroviral, RNAi
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    USP28 shRNA
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Entrez Gene

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII? (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer H1
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses

Depositor Comments

hairpin targets the sequence: GTATGGACAAGAGCGTTGGT

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRetrosuper USP28 shRNA-3 was a gift from Martin Eilers (Addgene plasmid # 15664 ; ; RRID:Addgene_15664)
  • For your References section:

    The ubiquitin-specific protease USP28 is required for MYC stability. Popov N, Wanzel M, Madiredjo M, Zhang D, Beijersbergen R, Bernards R, Moll R, Elledge SJ, Eilers M. Nat Cell Biol. 2007 Jul . 9(7):765-74. 10.1038/ncb1601 PubMed 17558397