pGL2 p15 4xSBR1 MutSBE
(Plasmid
#15718)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 15718 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGL2-E1bTATA
- Backbone size w/o insert (bp) 5600
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namep15 4xSBR1
-
Alt namep15INK4b 4xSBR1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)120
-
MutationMutant SBE (Smad binding element)
-
Entrez GeneCDKN2B (a.k.a. CDK4I, INK4B, MTS2, P15, TP15, p15INK4b)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer n/a
- 3′ sequencing primer LucNRev (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
SBR1 is one of the Smad Binding Regions on the p15INK4b promoter.
Smad binding element sequence - ACTAATTCGGGCAGAAAGACACATCCAAGAGAA
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL2 p15 4xSBR1 MutSBE was a gift from Joan Massague (Addgene plasmid # 15718 ; http://n2t.net/addgene:15718 ; RRID:Addgene_15718) -
For your References section:
C/EBPbeta at the core of the TGFbeta cytostatic response and its evasion in metastatic breast cancer cells. Gomis RR, Alarcon C, Nadal C, Van Poznak C, Massague J. Cancer Cell. 2006 Sep . 10(3):203-14. 10.1016/j.ccr.2006.07.019 PubMed 16959612
Map uploaded by the depositor.