Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSCMV-H2B-FT-Slow
(Plasmid #157671)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 157671 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSCMV
  • Backbone manufacturer
    Guo et al. 2012 (PMC3478612)
  • Backbone size w/o insert (bp) 7060
  • Total vector size (bp) 8173
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Histone H2B
  • Alt name
    H2B
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1113
  • Promoter CMV
  • Tag / Fusion Protein
    • Slow-FT (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer attaatacgactcactatagggag
  • 3′ sequencing primer tgagggctggataaagggag
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSCMV-H2B-FT-Slow was a gift from Shangqin Guo (Addgene plasmid # 157671 ; http://n2t.net/addgene:157671 ; RRID:Addgene_157671)
  • For your References section:

    Resolving Cell Cycle Speed in One Snapshot with a Live-Cell Fluorescent Reporter. Eastman AE, Chen X, Hu X, Hartman AA, Pearlman Morales AM, Yang C, Lu J, Kueh HY, Guo S. Cell Rep. 2020 Jun 23;31(12):107804. doi: 10.1016/j.celrep.2020.107804. 10.1016/j.celrep.2020.107804 PubMed 32579930