Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pIND-miR30
(Plasmid #15769)

Full plasmid sequence is not available for this item.

Loading...

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 15769 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    See comments
  • Backbone size w/o insert (bp) 5000
  • Vector type
    Mammalian Expression, RNAi
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    GT115 (InvivoGen)
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    miR30
  • Insert Size (bp)
    114

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site ApaI (not destroyed)
  • 5′ sequencing primer GTGCCACCTGACGTCGACGGA
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Purpose: inducible vector for cloning shRNAs. This vector was created by replacing the CMV promoter of pcDNA6.2-GW (Invitrogen, V49351) with five copies of E/GRE repeats and a minimal pol II promoter (from pIND), followed by miR-30 sequence from pSM2 (Open Biosystems, EVA4679).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pIND-miR30 was a gift from Danny Rangasamy (Addgene plasmid # 15769 ; http://n2t.net/addgene:15769 ; RRID:Addgene_15769)