CMV-10xQb oligo-library based
(Plasmid
#158201)
-
PurposeCassette of 10 different binding sites with high affinity to QB phage coat protein, as extracted from the oligo pool experiment.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 158201 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneCMV-SV40
- Backbone size w/o insert (bp) 3800
-
Vector typeMammalian Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name10 binding sites of QB based on oligo library experiment
-
SpeciesSynthetic
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GGCACCAAAATCAACGGGACTTTCCAAAATG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CMV-10xQb oligo-library based was a gift from Roee Amit (Addgene plasmid # 158201 ; http://n2t.net/addgene:158201 ; RRID:Addgene_158201) -
For your References section:
Overcoming the design, build, test bottleneck for synthesis of nonrepetitive protein-RNA cassettes. Katz N, Tripto E, Granik N, Goldberg S, Atar O, Yakhini Z, Orenstein Y, Amit R. Nat Commun. 2021 Mar 11;12(1):1576. doi: 10.1038/s41467-021-21578-6. 10.1038/s41467-021-21578-6 PubMed 33707432