AAV-hACE2-cMYC-Flag
(Plasmid
#158957)
-
PurposeUsed for expression of human ACE2 with AAV packaging
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 158957 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneAAV
- Backbone size w/o insert (bp) 5283
- Total vector size (bp) 7834
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHuman ACE2
-
Alt namehACE2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2444
-
Entrez GeneACE2 (a.k.a. ACEH)
- Promoter EF1a
-
Tags
/ Fusion Proteins
- Flag (C terminal on insert)
- MYC (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byOrigene
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
I have written confirmation from Origene that I can share this plasmid with Addgene for distribution
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-hACE2-cMYC-Flag was a gift from Akiko Iwasaki (Addgene plasmid # 158957 ; http://n2t.net/addgene:158957 ; RRID:Addgene_158957)