Skip to main content
Holiday Schedule: Addgene will be closed November 26th & 27th for the Thanksgiving Holiday. Order processing and shipping may be delayed during this week. For questions about your shipment please contact [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

AAV-hACE2-cMYC-Flag
(Plasmid #158957)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 158957 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    AAV
  • Backbone size w/o insert (bp) 5283
  • Total vector size (bp) 7834
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Human ACE2
  • Alt name
    hACE2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2444
  • Entrez Gene
    ACE2 (a.k.a. ACEH)
  • Promoter EF1a
  • Tags / Fusion Proteins
    • Flag (C terminal on insert)
    • MYC (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Origene
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

I have written confirmation from Origene that I can share this plasmid with Addgene for distribution

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-hACE2-cMYC-Flag was a gift from Akiko Iwasaki (Addgene plasmid # 158957 ; http://n2t.net/addgene:158957 ; RRID:Addgene_158957)