pET11a-STEPtag-L10-TAX
(Plasmid
#159374)
-
PurposeExpresses STEPtag fused to the N-terminus of inactive T. aurantiacus xylanase 10A, as a mock protein of interest.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 159374 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET-11a
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5677
- Total vector size (bp) 6517
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSTEPtag-L10-TAX
-
SpeciesSynthetic
-
Insert Size (bp)1374
- Promoter T7
-
Tag
/ Fusion Protein
- 6x His tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer T7 TAATACGACTCACTATAGGG
- 3′ sequencing primer T7 Terminal GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
TAX can be replaced with a protein of interest using the XhoI and BamHI sites. Ensure that the flexible ten amino acid linker between STEPtag and the protein of interest is present in the new fusion.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET11a-STEPtag-L10-TAX was a gift from Roberto Chica (Addgene plasmid # 159374 ; http://n2t.net/addgene:159374 ; RRID:Addgene_159374) -
For your References section:
Genetically Encoded Fluorescent Biosensor for Rapid Detection of Protein Expression. Eason MG, Pandelieva AT, Mayer MM, Khan ST, Garcia HG, Chica RA. ACS Synth Biol. 2020 Nov 20;9(11):2955-2963. doi: 10.1021/acssynbio.0c00407. Epub 2020 Oct 12. 10.1021/acssynbio.0c00407 PubMed 33044070