pET-gSTEP1
(Plasmid #159376)

• Purpose: Expresses gSTEP1 in E. coli
• Depositing Lab: Roberto Chica
• Publication: Eason et al ACS Synth Biol. 2020 Nov 20;9(11):2955-2963. doi: 10.1021/acssynbio.0c00407. Epub 2020 Oct 12.

Backbone

• Vector backbone: pET-Duet-1
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 5301
• Total vector size (bp): 6141
• Modifications to backbone: Deletion of most of MCS1
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: gSTEP1
• Species: Synthetic
• Insert Size (bp): 840
• Promoter: T7
• Tag / Fusion Protein:
  • 6x His tag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: DuetUP2 TTGTACACGGCCGCATAATC
• 3′ sequencing primer: T7 Terminal GCTAGTTATTGCTCAGCGG

Resource Information

• Supplemental Documents:
  • pET gSTEP1.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry