Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

vYM082_PB-pEF1s(min)-3xNLS-Citrine-T2A-iaaH(Hygro)
(Plasmid #160044)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 160044 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    PiggyBac
  • Backbone manufacturer
    SYSTEM BIOSCIENCE
  • Vector type
    Mammalian Expression, Synthetic Biology
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    iaaH
  • Entrez Gene
    iaaH (a.k.a. HXC48_RS00895, pTi-SAKURA_p184)
  • Promoter pEF1s
  • Tag / Fusion Protein
    • 3xNLS-Citrine (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TGGAGTAGCCATCACGTCACTGGC
  • 3′ sequencing primer GGTGTTCGGAAGTCCAGCGAAAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    vYM082_PB-pEF1s(min)-3xNLS-Citrine-T2A-iaaH(Hygro) was a gift from Michael Elowitz (Addgene plasmid # 160044 ; http://n2t.net/addgene:160044 ; RRID:Addgene_160044)
  • For your References section:

    Synthetic mammalian signaling circuits for robust cell population control. Ma Y, Budde MW, Mayalu MN, Zhu J, Lu AC, Murray RM, Elowitz MB. Cell. 2022 Mar 17;185(6):967-979.e12. doi: 10.1016/j.cell.2022.01.026. Epub 2022 Mar 1. 10.1016/j.cell.2022.01.026 PubMed 35235768