vYM082_PB-pEF1s(min)-3xNLS-Citrine-T2A-iaaH(Hygro)
(Plasmid
#160044)
-
PurposeFor expressing iaaH to convert auxin precursors (IAM or NAM) to auxin (IAA or NAA)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 160044 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonePiggyBac
-
Backbone manufacturerSYSTEM BIOSCIENCE
-
Vector typeMammalian Expression, Synthetic Biology
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameiaaH
-
Entrez GeneiaaH (a.k.a. HXC48_RS00895, pTi-SAKURA_p184)
- Promoter pEF1s
-
Tag
/ Fusion Protein
- 3xNLS-Citrine (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TGGAGTAGCCATCACGTCACTGGC
- 3′ sequencing primer GGTGTTCGGAAGTCCAGCGAAAT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
vYM082_PB-pEF1s(min)-3xNLS-Citrine-T2A-iaaH(Hygro) was a gift from Michael Elowitz (Addgene plasmid # 160044 ; http://n2t.net/addgene:160044 ; RRID:Addgene_160044) -
For your References section:
Synthetic mammalian signaling circuits for robust cell population control. Ma Y, Budde MW, Mayalu MN, Zhu J, Lu AC, Murray RM, Elowitz MB. Cell. 2022 Mar 17;185(6):967-979.e12. doi: 10.1016/j.cell.2022.01.026. Epub 2022 Mar 1. 10.1016/j.cell.2022.01.026 PubMed 35235768