Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pML104-natR412
(Plasmid #162042)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 162042 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pML104
  • Backbone size w/o insert (bp) 11240
  • Total vector size (bp) 11258
  • Vector type
    Yeast Expression, CRISPR
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    natR412 guide
  • Species
    Synthetic
  • Insert Size (bp)
    33

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SwaI (destroyed during cloning)
  • 3′ cloning site BclI (destroyed during cloning)
  • 5′ sequencing primer T3
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid is derived from Addgene plasmid #67638 pML104 (deposited by John Wyrick) with an inserted guide sequence using the BclI-SwaII restriction sites.
Guide sequence: GTACCGCACCAGTGTCCCGG

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pML104-natR412 was a gift from Jolanda Van Leeuwen (Addgene plasmid # 162042 ; http://n2t.net/addgene:162042 ; RRID:Addgene_162042)
  • For your References section:

    Natural variants suppress mutations in hundreds of essential genes. Parts L, Batte A, Lopes M, Yuen MW, Laver M, San Luis BJ, Yue JX, Pons C, Eray E, Aloy P, Liti G, van Leeuwen J. Mol Syst Biol. 2021 May;17(5):e10138. doi: 10.15252/msb.202010138. 10.15252/msb.202010138 PubMed 34042294