LAMP1-GFP
(Plasmid #16290)

• Depositing Lab: Ron Vale
• Publication: Minin et al J Cell Sci. 2006 Feb 15. 119(Pt 4):659-70.

Backbone

• Vector backbone: pAc5.1/V5-His B
• Backbone size w/o insert (bp): 5400
• Vector type: Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: LAMP1/RE72002
• Species: D. melanogaster (fly)
• Insert Size (bp): 954
• Promoter: Ac5
• Tag / Fusion Protein:
  • EGFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Kpn I (not destroyed)
• 3′ cloning site: Not I (not destroyed)
• 5′ sequencing primer: AC5 (ACACAAAGCCGCTCCATCAG)
• 3′ sequencing primer: EBV-rev

Resource Information

• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that KpnI is not a unique site, as it flanks LAMP1.