nuc-mCherry-pTRIP
(Plasmid
#163520)
-
PurposeUsed to construct lentivirus to express nucleus-targeted mCherry in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 163520 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepTRIP-Puro-2A
-
Backbone manufacturerAddgene
-
Modifications to backboneMultiple cloning sites added.
-
Vector typeMammalian Expression, Bacterial Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namenucleus targeted mCherry
-
SpeciesSynthetic
-
Insert Size (bp)904
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xba1 (unknown if destroyed)
- 3′ cloning site BamH1 (unknown if destroyed)
- 5′ sequencing primer TTTGGCAGTACACCAATGGG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Created by Ananda Mookerjee and Thomas Weber.
Contains SV40 Large T NLS (3X) at the N-terminal of mCherry (in frame) and a cMyc NLS at the C-terminal of mCherry
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
nuc-mCherry-pTRIP was a gift from Thomas Weber (Addgene plasmid # 163520 ; http://n2t.net/addgene:163520 ; RRID:Addgene_163520)