Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

p246 eSpCas9_2gRNAs_mH11
(Plasmid #164854)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 164854 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    eSpCas9(1.1) Addgene #71814
  • Backbone manufacturer
    eSpCas9(1.1) Addgene #71814
  • Total vector size (bp) 8936
  • Vector type
    Mammalian Expression
  • Selectable markers
    None

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gRNAs for targeting mouse H11 locus
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI and BsaI (destroyed during cloning)
  • 3′ cloning site BbsI and BsaI (destroyed during cloning)
  • 5′ sequencing primer cgtgacgtagaaagtaataatt
  • 3′ sequencing primer gtccctattggcgttactat
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Additional gRNA block was cut and cloned from Addgene #64073 pX333 into Addgene #71814 eSpCas9(1.1) using restriction enzymes XbaI and KpnI

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p246 eSpCas9_2gRNAs_mH11 was a gift from Philip Jordan (Addgene plasmid # 164854 ; http://n2t.net/addgene:164854 ; RRID:Addgene_164854)
  • For your References section:

    Adaptation of the AID system for stem cell and transgenic mouse research. Pryzhkova MV, Xu MJ, Jordan PW. Stem Cell Res. 2020 Nov 5;49:102078. doi: 10.1016/j.scr.2020.102078. 10.1016/j.scr.2020.102078 PubMed 33202307