dCas9-MSK1
(Plasmid
#165601)
-
PurposeExpresses Sp dCas9 fused to human MSK1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 165601 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneLentiCRISPR v2
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsStbl3 is also a suitable growth strain
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameribosomal protein S6 kinase A5
-
SpeciesH. sapiens (human), Synthetic; S. Pyogenes
-
Insert Size (bp)6564
-
GenBank IDNM_001322227.2
-
Entrez GeneRPS6KA5 (a.k.a. MSK1, MSPK1, RLPK)
- Promoter EF1a
-
Tag
/ Fusion Protein
- FLAG Tag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATCCGGTGCCTAGAGAAGGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
dCas9-MSK1 was a gift from Isaac Hilton (Addgene plasmid # 165601 ; http://n2t.net/addgene:165601 ; RRID:Addgene_165601) -
For your References section:
Programmable human histone phosphorylation and gene activation using a CRISPR/Cas9-based chromatin kinase. Li J, Mahata B, Escobar M, Goell J, Wang K, Khemka P, Hilton IB. Nat Commun. 2021 Feb 9;12(1):896. doi: 10.1038/s41467-021-21188-2. 10.1038/s41467-021-21188-2 PubMed 33563994