Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

dCas9-hHDAC3
(Plasmid #98591)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 98591 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    plenti
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    dCAS9-HDAC3
  • Species
    H. sapiens (human), Synthetic; S. pyogenes
  • Mutation
    D10A and N863A in Cas9
  • GenBank ID
    NM_003883
  • Entrez Gene
    HDAC3 (a.k.a. HD3, KDAC3, RPD3, RPD3-2)
  • Promoter EF1A

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GTTTGGATCTTGGTTCATTCTCAAGCCTCAG
  • 3′ sequencing primer cacatagcgtaaaaggagcaacatag
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    human HDAC3 cDNA from Addgene plasmid HDAC3-Flag (#13819) plenti vector containing dCas9_2A_Blast from Addgene plasmid (#61425)
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The stop codon present after the HDAC3 open reading frame may interfere with expression of the blasticidin resistance cassette. Blasticidin selection has not been verified with this plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    dCas9-hHDAC3 was a gift from Zhaolan Zhou (Addgene plasmid # 98591 ; http://n2t.net/addgene:98591 ; RRID:Addgene_98591)
  • For your References section:

    Locus-specific histone deacetylation using a synthetic CRISPR-Cas9-based HDAC. Kwon DY, Zhao YT, Lamonica JM, Zhou Z. Nat Commun. 2017 May 12;8:15315. doi: 10.1038/ncomms15315. 10.1038/ncomms15315 PubMed 28497787