pLV-dCas9-p300-P2A-PuroR
(Plasmid #83889)

• Purpose: Lentiviral Sp dCas9-p300-P2A-PuroR
• Depositing Lab: Charles Gersbach
• Publication: Klann et al Nat Biotechnol. 2017 Apr 3. doi: 10.1038/nbt.3853.

Backbone

• Vector backbone: lentiCRISPR v2
• Backbone size w/o insert (bp): 7800
• Total vector size (bp): 14538
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: S.pyogenes dCas9 with c-terminal human p300 Core effector fusion (aa 1048-1664 of human p300)
• Species: H. sapiens (human), Synthetic; S. pyogenes
• Insert Size (bp): 6138
• Mutation: D10A; H840A in S.pyogenes Cas9
• GenBank ID: WP_010922251.1 NP_001420.2
• Entrez Gene: EP300 (a.k.a. KAT3B, MKHK2, RSTS2, p300)
• Promoter: EFS
• Tags / Fusion Proteins:
  • nucleoplasmin NLS (C terminal on insert)
  • Flag (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ATCCGGTGCCTAGAGAAGGT

Gene/Insert 2

• Gene/Insert name: pac from Streptomyces alboniger
• Alt name: puromycin N-acetyltransferase
• Species: Streptomyces alboniger
• Insert Size (bp): 597

Resource Information

• Supplemental Documents:
  • GenBank File
• Articles Citing this Plasmid:
  • 9 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry