PB-TRE-dCas9-VPR-pA-3xsgRNA-EF1a-Tet.O-T2A-PuroR-polyA
(Plasmid #166693)

• Purpose: Express dCas9-VPR in a doxycyclin-inducable system and 3 sgRNAs targeting the murine Cnga1 promoter. Can be stably integrated into the genome via the PiggyBac Transposon system.
• Depositing Lab: Elvir Becirovic
• Publication: Bohm et al Sci Adv. 2020 Aug 19;6(34):eaba5614. doi: 10.1126/sciadv.aba5614. eCollection 2020 Aug.

Backbone

• Vector backbone: PiggyBac
• Backbone size w/o insert (bp): 7250
• Total vector size (bp): 14555
• Vector type: Mammalian Expression, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: dCas9-VPR
• Species: Streptococcus pyogenes
• Insert Size (bp): 7300
• Promoter: TRE

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: Eco105I (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: cgtaccacttcctaccctcg

Gene/Insert 2

• Gene/Insert name: 3x Cnga1 promoter-targeting sgRNAs
• Species: Streptococcus pyogenes
• Promoter: U6

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: XmaJI (not destroyed)
• 3′ cloning site: PacI (not destroyed)
• 5′ sequencing primer: GCGGCAGGCCCTGCCATAGC
• 3′ sequencing primer: ACACAAAAAACCAACACACAGA

Resource Information

• Supplemental Documents:
  • pB-TRE-dCas9-VPR-polyA-3xsgRNA-EF1a-Tet.O-T2APuroR-SV40polyA.gb
• A portion of this plasmid was derived from a plasmid made by: SP-dCas9-VPR, Addgene plasmid 63798

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry