Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCW-Cas9-2A-EGFP
(Plasmid #167928)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 167928 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCW-Cas9
  • Backbone manufacturer
    Eric Lander, David Sabatini (Addgene Plasmid #50661)
  • Backbone size w/o insert (bp) 11885
  • Total vector size (bp) 12674
  • Modifications to backbone
    Replacing the FseI-BamHI fragment in the backbone with the T2A-EGFP fragment.
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    T2A-EGFP
  • Insert Size (bp)
    856
  • Promoter tTRE, hPGK

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer 5'- AGCTCGTTTAGTGAACCGTCAGATC -3'
  • 3′ sequencing primer 5'- GAACGGACGTGAAGAATGTG -3'
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCW-Cas9-2A-EGFP was a gift from Ronald Germain (Addgene plasmid # 167928 ; http://n2t.net/addgene:167928 ; RRID:Addgene_167928)
  • For your References section:

    Efficient Immune Cell Genome Engineering with Enhanced CRISPR Editing Tools. Chan W, Gottschalk RA, Yao Y, Pomerantz JL, Germain RN. Immunohorizons. 2021 Feb 23;5(2):117-132. doi: 10.4049/immunohorizons.2000082. 10.4049/immunohorizons.2000082 PubMed 33622708